guuaaaacucuucucaugcuggauucgaaauuaggugcgcuucgcguuuaaguc
The query sequence (length=54) is searched through a non-redundant set of database sequences rna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 8z99:M | 54 | 54 | 1.0000 | 1.0000 | 1.0000 | 4.78e-23 | |
2 | 8yhd:M | 53 | 53 | 0.9815 | 1.0000 | 1.0000 | 1.72e-22 | |
3 | 8z4l:M | 49 | 49 | 0.9074 | 1.0000 | 1.0000 | 2.87e-20 | |
4 | 8z9c:M | 48 | 48 | 0.8889 | 1.0000 | 1.0000 | 1.03e-19 | |
5 | 8yhe:M | 46 | 46 | 0.8519 | 1.0000 | 1.0000 | 1.34e-18 | |
6 | 8z99:N | 46 | 40 | 0.7407 | 0.8696 | 1.0000 | 2.89e-15 | |
7 | 8z9e:M | 39 | 39 | 0.7222 | 1.0000 | 1.0000 | 1.04e-14 | |
8 | 8z4j:M | 38 | 38 | 0.7037 | 1.0000 | 1.0000 | 3.74e-14 | |
9 | 8z9c:N | 41 | 35 | 0.6481 | 0.8537 | 1.0000 | 1.74e-12 | |
10 | 8z4l:N | 40 | 34 | 0.6296 | 0.8500 | 1.0000 | 6.27e-12 | |
11 | 8yhd:N | 35 | 34 | 0.6296 | 0.9714 | 1.0000 | 6.27e-12 | |
12 | 8z4j:N | 34 | 28 | 0.5185 | 0.8235 | 1.0000 | 1.36e-08 | 8z9e:N |
13 | 8yhe:N | 30 | 28 | 0.5185 | 0.9333 | 1.0000 | 1.36e-08 |