gcacaaatccattgacaaaagaaggctaaaagggca
The query sequence (length=36) is searched through a non-redundant set of database sequences dna_nr.fasta.gz clustered at 100% identity cutoff to identify representative hits. Homologs that belong to the same sequence cluster of the representative hit are listed in the last column of the table.
# | Hit | Hit length |
Aligned length |
Identity (normalized by query) |
Identity (normalized by hit) |
Identity (normalized by aligned length) |
E-value | Homologs to hit |
---|---|---|---|---|---|---|---|---|
1 | 6psr:O | 36 | 36 | 1.0000 | 1.0000 | 1.0000 | 1.63e-14 | |
2 | 6psw:P | 62 | 35 | 0.9722 | 0.5645 | 1.0000 | 5.87e-14 | |
3 | 6psw:O | 62 | 35 | 0.9722 | 0.5645 | 1.0000 | 5.87e-14 | |
4 | 6psv:P | 50 | 35 | 0.9722 | 0.7000 | 1.0000 | 5.87e-14 | |
5 | 6psv:O | 55 | 35 | 0.9722 | 0.6364 | 1.0000 | 5.87e-14 | |
6 | 6psu:P | 37 | 35 | 0.9722 | 0.9459 | 1.0000 | 5.87e-14 | |
7 | 6psu:O | 42 | 35 | 0.9722 | 0.8333 | 1.0000 | 5.87e-14 | |
8 | 6pst:O | 50 | 35 | 0.9722 | 0.7000 | 1.0000 | 5.87e-14 | |
9 | 6pss:O | 43 | 35 | 0.9722 | 0.8140 | 1.0000 | 5.87e-14 | |
10 | 6psr:P | 35 | 35 | 0.9722 | 1.0000 | 1.0000 | 5.87e-14 | |
11 | 6psq:P | 50 | 35 | 0.9722 | 0.7000 | 1.0000 | 5.87e-14 | |
12 | 6psq:O | 50 | 35 | 0.9722 | 0.7000 | 1.0000 | 5.87e-14 | |
13 | 6oul:P | 61 | 35 | 0.9722 | 0.5738 | 1.0000 | 5.87e-14 | |
14 | 6pst:P | 51 | 34 | 0.9444 | 0.6667 | 1.0000 | 2.11e-13 | |
15 | 6pss:P | 43 | 34 | 0.9444 | 0.7907 | 1.0000 | 2.11e-13 | |
16 | 6oul:Q | 56 | 34 | 0.9444 | 0.6071 | 1.0000 | 2.11e-13 |