Zhang Lab

National University of Singapore

Home Research COVID-19 Services Publications People Teaching Job Opening News Forum Lab Only

Online Services

●I-TASSER ●I-TASSER-MTD ●C-I-TASSER ●CR-I-TASSER ●QUARK ●C-QUARK ●LOMETS ●MUSTER ●CEthreader ●SEGMER ●DeepFold ●DeepFoldRNA ●FoldDesign ●COFACTOR ●COACH ●MetaGO ●TripletGO ●IonCom ●FG-MD ●ModRefiner ●REMO ●DEMO ●DEMO-EM ●SPRING ●COTH ●Threpp ●PEPPI ●BSpred ●ANGLOR ●EDock ●BSP-SLIM ●SAXSTER ●FUpred ●ThreaDom ●ThreaDomEx ●EvoDesign ●BindProf ●BindProfX ●SSIPe ●GPCR-I-TASSER ●MAGELLAN ●ResQ ●STRUM ●DAMpred

●TM-score ●TM-align ●US-align ●MM-align ●RNA-align ●NW-align ●LS-align ●EDTSurf ●MVP ●MVP-Fit ●SPICKER ●HAAD ●PSSpred ●3DRobot ●MR-REX ●I-TASSER-MR ●SVMSEQ ●NeBcon ●ResPRE ●TripletRes ●DeepPotential ●WDL-RF ●ATPbind ●DockRMSD ●DeepMSA ●FASPR ●EM-Refiner ●GPU-I-TASSER

●BioLiP ●E. coli ●GLASS ●GPCR-HGmod ●GPCR-RD ●GPCR-EXP ●Tara-3D ●TM-fold ●DECOYS ●POTENTIAL ●RW/RWplus ●EvoEF ●HPSF ●THE-DB ●ADDRESS ●Alpaca-Antibody ●CASP7 ●CASP8 ●CASP9 ●CASP10 ●CASP11 ●CASP12 ●CASP13 ●CASP14

BioLiP

Structure of PDB 1am9 Chain B Binding Site BS01

Receptor Information

>1am9 Chain B (length=75) Species: 9606 (Homo sapiens) [Search protein sequence] [Download receptor structure] [Download structure with residue number starting from 1] [View receptor structure]

SRGEKRTAHNAIEKRYRSSINDKIIELKDLVVGTEAKLNKSAVLRKAIDY
IRFLQHSNQKLKQENLSLRTAVHKS

Ligand information

>1am9 Chain F (length=21) [Search DNA sequence] [Download ligand structure] [Download structure with residue number starting from 1] [View ligand structure]

catgagatcaccccactgcaa

Receptor-Ligand Complex Structure

Global view

Local view

Structure summary

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]

[Spin on] [Spin off] [Reset]
[High quality] [Low quality]
[White background] [Black background]

PDB	1am9 Co-crystal structure of sterol regulatory element binding protein 1a at 2.3 A resolution.
Resolution	2.3 Å
Binding residue (original residue number in PDB)	R325 N329 E332 K333 R336 N358 K359
Binding residue (residue number reindexed from 1)	R6 N10 E13 K14 R17 N39 K40

Enzymatic activity

Enzyme Commision number

Gene Ontology

	Molecular Function
GO:0046983	protein dimerization activity

View graph for
Molecular Function

External links

PDB	RCSB:1am9, PDBe:1am9, PDBj:1am9
PDBsum	1am9
PubMed	9634703
UniProt	P36956\|SRBP1_HUMAN Sterol regulatory element-binding protein 1 (Gene Name=SREBF1)

[Back to BioLiP]

zhanglabzhanggroup.org | +65-6601-1241 | Computing 1, 13 Computing Drive, Singapore 117417